Filtyp
The WHO has ranked environmental hazardous exposures in the living and working environment among the top risk factors for chronic disease mortality. Worldwide, about 40 million people die each year from noncommunicable diseases (NCDs) including cancer, diabetes, and chronic cardiovascular, neurological and lung diseases. The exposure to ambient pollution in the living and working environment is ex
Despite controversies, flu vaccine programs targeted to the older people are highly recommended and represent a common public health policy in industrialized Countries. Although demographic aging will increase the share of population at higher risk of influenza, today economic recession is putting public budgets under pressure. Underfunding of prevention is becoming a larger problem, as prevention
BACKGROUND: Chronic obstructive pulmonary disease (COPD) and asthma are common diseases with a heterogeneous distribution worldwide. Here, we present methods and disease and risk estimates for COPD and asthma from the Global Burden of Diseases, Injuries, and Risk Factors (GBD) 2015 study. The GBD study provides annual updates on estimates of deaths, prevalence, and disability-adjusted life years (
This study aimed to explore the value of synchrotron-based phase-contrast microcomputed tomography (micro-CT) in pulmonary vascular pathobiology. The microanatomy of the lung is complex with intricate branching patterns. Tissue sections are therefore difficult to interpret. Recruited intrapulmonary bronchopulmonary anastomoses (IBAs) have been described in several forms of pulmonary hypertension,
Purpose - The purpose of this article is to argue that consumers experience conflict not only when in identity transitions or social status transitions but also in-between these two, and that the relationship between these two is becoming increasingly important to address. First, this is done by identifying how status transitions (vertical movements) overlap but differ in some important respects f
Evidence for an involvement of striatal D1 receptors in levodopa-induced dyskinesia has been presented whereas the contribution of striatal D2 receptors remains controversial. In addition, whether D1 and D2 receptors located in the substantia nigra reticulata shape the response to levodopa remains unknown. We therefore used dual probe microdialysis to unravel the impact of striatal and nigral D1 o
The invention relates to a method of 13C-MR detection using an imaging medium comprising hyperpolarised 13C-lactate and to an imaging medium containing hyperpolarised 13C1-lactate for use in said method.
Denna studie har syftat till att kartlägga allmänbefolkningens exponering för vissa luftburna cancerframkallande ämnen: bensen, 1,3-butadien, formaldehyd, kvävedioxid, kväveoxid samt ozon. Undersökningen genomfördes i Malmö under hösten 2014 och inkluderade totalt 42 slumpvis utvalda malmöbor i åldrarna 20-50 år. Samtliga mätningar, bortsett från formaldehyd, upprepades på 22 personer. Tjugo av de
The present contribution focuses on the mathematical techniques used to solve steady state metabolic models for the case of an overdetermined system. Even when parts of the system are underdetermined it is possible to solve the model partially and obtain statistically meaningful results. This is illustrated with data gathered from a set of E. coli W3110.shik1 phosphate- or carbon-limited continuou
Developmental dysplasia of the hip (DDH) is associated with an increased risk of early hip osteoarthritis (OA). We aimed to examine the outcome at the completion of growth in a cohort of children who had residual acetabular dysplasia at age 1 year following early treatment for neonatal instability of the hip (NIH).
1(3) Saco-S-rådet PROTOKOLL Linköpings universitet fört vid styrelsemöte 2026-01-14 Styrelsen Närvarande: Krzysztof Marciniak, ITN, ordförande Peter Hult, IMT Kjell Karlsson, ITN Åsa Rybo Landelius, IFM Torbjörn Larsson, MAI Janerik Lundquist, IEI David Rule, MAI Carina Wennerholm, HMV Therese Winder, UF Anders Hallqvist, IBL, suppleant Maria Hedtjärn, UF, suppleant Tove Mattsson, IBL, suppleant D
It is argued, that the use of water can no longer be regarded as an almost free commodity. The idea to assess and value the environmental impact of the water use represents a true change of paradigm. The key issue is that any future wastewater treatment system has to be evaluated according to a quantitative criterion. This has to consider: •hygienic aspects: we believe that nobody will accept a l
Popular Abstract in English Imagine a solar powered flash light. Each photon absorbed by the flash light’s solar cell creates electric energy and the flash light’s light source converts the electrical energy again into photons. The purpose of such a device may be questionable, because you would be surprised if it would create more light than what it absorbs. However, under certain conditions it isIn this thesis the luminescence properties of highly doped semiconductors are studied with focus on degenerately n-doped InP. It is demonstrated how photoluminescence measurements on degenerately doped semiconductors allow an estimation of the doping concentration without need for electrical contacts. The degenerate doping can furthermore reveal the conduction band structure for energies higher th
Popular Abstract in English ...GTAAAAATTAAGCACAGTGGAAGAATTTCATTCTGTTCTCAGTTTTCCTGGAT TATGCCTGGCACCATTAAAGAAAATATCTTTGGTGTTTCCTATGATGAATATAGATACA GAAGCGTCATCAAAGCATGCCAACTAGAAGAG1.... The string of these block letters (A, T, C and G) is a tiny part of the human DNA sequence, which is more than 3 billion letters long. The combination of these block letters carries genetic information, similar to howThe importance of nucleic acids in pure form for preparative and analytical perspectives, have increased constantly, demanding the development of new and more efficient methods for their recovery and isolation. This thesis describes a series of different innovative methods for recovery and purification of these biomolecules. In a general overview of a downstream processing, there are several criti
This thesis explores the relationship between two important legal principles in European Union law: the requirement for ‘complete data sets’ in Article 10 of the Artificial Intelligence Act (AI Act) and the principle of ‘data minimisation’ in Article 5(1)(c) of the General Data Protection Regulation (GDPR). The AI Act requires that high-risk AI systems be trained on data that is representative, a
Peacebuilding initiatives play an important role in the reconstruction of political, economic, and social conditions after internal armed conflicts. If these initiatives also account for environmental aspects, they have the potential to address both ecological damages and resource-related conflict causes. The sprawling literature on environmental peacebuilding therefore stresses the need for a hol
Purpose: To present the outcomes of a randomised clinical trial for the treatment of progressive keratoconus using different kinds of riboflavin and the addition of sterile water in thin corneae. Methods: A randomised study using epithelium-off corneal cross-linking (CXL) with continuous UVA irradiance 9 mW/cm2 for 10 min (total fluence 5.4 J/cm2) and two kinds of riboflavin solutions: (i) isoosmo
