Sökresultat

Microsoft Word - vicerektors tillägg nyhetsbrevet mars.docx Nyhetsbrev  från  vicerektor  mars  2016:     1. Arbetet  med  den  strategiska  planen  2027-­‐2026  fortskrider  och  nu  finns  en  första  version,   som  kan  ses  på  hemsidan  för  strategiska  planen.  Välkomna  att  ge  synpunkter  och  välkomna   till  nästa  rektorsseminarium  om  planen,  den  22  mars.  Då  kommer  planen  at

https://www.medarbetarwebben.lu.se/sites/medarbetarwebben.lu.se/files/vicerektors_tillagg_nyhetsbrevet_mars.pdf - 2026-07-02

Brevmall Postadress Box 114,221 00 Lund Besöksadress Paradisgatan 5, hus G Telefon växel 046-222 00 00 Fax 046-222 41 00 Webbadress http://www.soc.lu.se Soc io log iska ins t i tu t ionen Schema Delkurs 1 (period 1-2) Kriminologisk teori och forskning 15 hp *Se adresser till lokaler på sista sidan Datum Tid Rum Lära re Aktivitet Innehåll 2/9 13-16 Stadshallens sessionssal* KG Kurs-information Obli

https://www.soclaw.lu.se/sites/soclaw.lu.se/files/schema_soca73.pdf - 2026-07-02

Abstract in Undetermined In this paper, the news aggregator GoogleNews is used to assess the impact ofworldwide news on the volatility of the Chinese stock market. Although we find a strong link between the global stock market volatility and the amount of stock market-related news available worldwide, the link between the Chinese stock market and the same set of worldwide news is found to be much

Background: Antithrombin concentrate (AT) is used to treat heparin resistance (HR) in cardiac surgery. It is usually given slowly due to the fear of anaphylaxis. This may delay cardiac catheterisation and the start of cardiopulmonary bypass (CPB). HR is often defined as the failure to reach or maintain a target activated clotting time (ACT) despite a standard dose of heparin. It is not generally p

Bild 1 Up to now… What is geographic data: Locational – Vector, Raster Properties of geographic data: Geometry, Descriptions (attributes), Topology Visualization of geographic data: Cartography, Data characteristics (qualitative – quantitative), Graphic variables Vector data  Vector structure & RDB: Computer storage of geometry and attributes, Principles & rules Relational Databases/Structured Qu

https://www.nateko.lu.se/sv/sites/nateko.lu.se.sv/files/4_5_vector_analysis_theory_kl_eng_ht17.pptx - 2026-07-02

The purpose of this study was to get a better understanding of why professionals in social work or field work don’t work with questions regarding sexual health for people with an intellectual disability. We hope that this study could provide more knowledge on how professionals guide or don’t guide individuals with an intellectual disability in their sexual health and open up the discussion on the

Abstract Title: Maximizing Value-to-Effort using Digital Twins in a Rapidly Moving Supply Network Authors: André Laurent – Hedlund & Oskar Helén Cedergren Supervisors: Sandeep Jagtap, Senior Lecturer at Engineering Logistics, Faculty of Engineering (LTH) at Lund University Digitalization Manager at The Company Examiner: Andreas Norrman, Professor at Engineering Logistics, Faculty of Enginee

År 2018 antogs den så kallade samtyckeslagen. Genom denna lagstiftningsreform skiftades fokuset i den svenska våldtäktsbestämmelsen från förekomsten av våld, hot och utnyttjande av offrets särskilt utsatta situation, till huruvida offret deltagit frivilligt. På så sätt markerades att det inte är tillåtet att företa sexuella handlingar med en person som inte själv har fått bestämma att denne vill dIn 2018, the so-called consent act was adopted. This legislative reform shifted the focus of the Swedish rape provision from the presence of violence, threats and exploitation of the victim's particularly vulnerable situation, to whether the victim participated voluntarily. This emphasised that it is not permitted to engage in sexual acts with a person who has not been allowed to decide that t

By recent advancements in information technology and artificial intelligence, the chatbot has become a promising venture to streamline the key business function that is customer support, concurrently as the worry of AI taking jobs are rising. This raise concern that a chatbot adoption in the customer support would be underutilized due to negative pre-implementation attitudes of the workforce and u

A network mechanics model for analysis of materials made of dry-shaped cellulose fibres is proposed. In terms of the model, the network is composed of fibres of arbitrary distribution in length, curvature, cross-section. stiffness and strength. The fibres are arranged in a random structure according to an arbitrary orientation distribution. Where fibres meet there may be fibre-to-fibre interaction

This thesis deals with local government bodies, especially municipalities, as parties to contracts. It primarily focuses on general problems relating to the competence of a municipality to enter into contracts, and the subsequent legal effects, in light ofthe principles and rules ofpublic and private law. When analysing a contract to which a governmental body is a party, it is necessary to conside

To remain competitive in the field of manufacturing today, companies must make their industrial robots smarter and allow them to collaborate with one another in a more effective manner. This is typically done by adding some form of learning, or artificial intelligence (AI), to the robots. These learning algorithms are often packaged as cloud functions in a remote computational center since the a

On 31 January 2018, the Danish Competition and Consumer Authority adopted a decision that found the Swedish company CD Pharma, a generic distributor, to be in breach of Article 102(a) TFEU due to having abused its dominant position and imposed excessive and unfair prices for the drug Syntocinon. The company had increased the price of the drug by 2000% on the Danish market in the period April 2014-

The Japanese avant-garde dance form butoh, founded by Hijikata Tatsumi in the late 1950s, is known for its marked physicality. The choreographic methodology of butoh, however, is not focused primarily on instructing the dancers how to move their bodies. Instead, the dancers work with verbal and mental imagery to transform into butoh-tai, the “butoh body,” a special form of embodiment from which th

Popular Abstract in English Imagine a solar powered flash light. Each photon absorbed by the flash light’s solar cell creates electric energy and the flash light’s light source converts the electrical energy again into photons. The purpose of such a device may be questionable, because you would be surprised if it would create more light than what it absorbs. However, under certain conditions it isIn this thesis the luminescence properties of highly doped semiconductors are studied with focus on degenerately n-doped InP. It is demonstrated how photoluminescence measurements on degenerately doped semiconductors allow an estimation of the doping concentration without need for electrical contacts. The degenerate doping can furthermore reveal the conduction band structure for energies higher th

Popular Abstract in English ...GTAAAAATTAAGCACAGTGGAAGAATTTCATTCTGTTCTCAGTTTTCCTGGAT TATGCCTGGCACCATTAAAGAAAATATCTTTGGTGTTTCCTATGATGAATATAGATACA GAAGCGTCATCAAAGCATGCCAACTAGAAGAG1.... The string of these block letters (A, T, C and G) is a tiny part of the human DNA sequence, which is more than 3 billion letters long. The combination of these block letters carries genetic information, similar to howThe importance of nucleic acids in pure form for preparative and analytical perspectives, have increased constantly, demanding the development of new and more efficient methods for their recovery and isolation. This thesis describes a series of different innovative methods for recovery and purification of these biomolecules. In a general overview of a downstream processing, there are several criti