Filtyp
greening local e-commerce Lund University International Master’s Programme in Environmental Science LUMES Greening of Local E-commerce How to Realise the Environmental Potential of Online Grocery Trade - A Case Study in the City of Lund Yujing Li Supervisors: Peter Arnfalk Petra Wilhelmsson Thesis for the fulfilment of the Lund University International Master’s Programme in Environmental
https://www.lumes.lu.se/sites/lumes.lu.se/files/li_yujing.pdf - 2026-05-20
Nature on School grounds: for Learning, Health, and Sustainability Nature on School grounds: for Learning, Health, and Sustainability BECC POLICY BRIEF | 01 · 2024 BECC POLICY BRIEF | 01 · 2024 | | | | | | | | | | | | | | | | | | | - - - - - - - Nature on School grounds: for Learning, Health, and Sustainability ANNA S. PERSSON (ed.) Centre for Environmental and Climate Science (CEC), Lund Universi
Introduction Episodic memory allows us to revisit our past and recollect inter-related elements that characterize life events (Tulving, 1983). When forming such relational memories, we only apprehend a small part of our visual field in full acuity at a time. This limitation is overcome by shifting visual attention over a sequence of eye movements. We bind these visual “samples” of the world into
Uppsatsen har som syfte att redogöra för alkoholpolitiken som bedrivs och som har bedrivits i Sverige och dess förhållande till EU-rätten, samt att redogöra för den alkohol- och hälsopolitik EU bedriver. Utöver diskuteras den fria rörligheten och alkoholimport. Sverige har sedan länge haft lagar som syftar till att begränsa de problem som är förknippade med alkohol. De allra tidigaste lagarna fråThe main purpose of this essay is to discuss Swedish politics on the alcohol field, and its problems when it comes to the treaties of the EU. In addition, I also want to write about the alcohol and health policy of the EU. Sweden has since many hundred years had problems associated with alcohol. The earliest laws came during the 1500s and provided penalty for drunkenness. Gradually our law maker b
The enzymatic interesterification of a solvent-free, equimolar mixture of trilaurin and 1,3-palmitin-2-olein was studied using three immobilized lipase preparations as catalysts. Analysis of triacylglycerol (TAG) content and fatty acid (FA) distribution monitored the lipase-catalyzed interesterification in sn-1,3 positions and FA exchange in the sn-2 position caused by acyl migration. Lipase from
Radionuclide therapy (RNT), is important for the treatment of certain benign and malignant diseases. 90Y-Zevalin™ therapy has become an established method of treating patients with non-Hodgkin B-cell lymphoma. Several observ¬ations regarding the outcome of therapy have prompted the use of higher absorbed doses by administering larger amounts of activity than those indicated in standard protocols.
The emittances of the electron beams at the MAX-laboratory accelerator system have been studied. Apart from the build-up of the diagnostic tools for precise determination of the beam spatial profiles, the objectives have been: a) to verify the accelerator design emittances at low currents and to try to determine the emittances also at high currents; b) to investigate possibilities to manipulate th
It is argued, that the use of water can no longer be regarded as an almost free commodity. The idea to assess and value the environmental impact of the water use represents a true change of paradigm. The key issue is that any future wastewater treatment system has to be evaluated according to a quantitative criterion. This has to consider: •hygienic aspects: we believe that nobody will accept a l
Background: Anti-neutrophil cytoplasmic antibodies associated vasculitides (AAV) are characterized by autoimmune small vessel inflammation. Eosinophils are multifunctional cells with both pro-inflammatory and immunoregulatory properties. Tissue activated eosinophils secrete cyto- and chemokines and form extracellular traps (EETs), they release free granules and produce reactive oxygen species. The
Background: Health-related quality of life (HRQoL) was a secondary end point in AGO-OVAR 16, which randomized 940 patients with EOC after first-line chemotherapy to maintenance pazopanib (PZ) or placebo (P). Additional post hoc analyses were carried out to investigate additional patient-centered end points. Patients and methods: HRQoL was measured with EORTC-QLQ-C30, QLQ-OV28 and EQ-5D-3L. Pre-spe
Capsazepine is known as a transient receptor potential channel vanilloid subfamily 1 (TRPV1) antagonist that inhibits bronchoconstriction evoked in animals by TRPV1 agonists. In this study, effects of capsazepine and chemically related analogues, so called capsazepinoids, were examined in vitro on contractile effects in human small airway preparations. Repeated cycles with 1 h of LTD4-free physiol
Popular Abstract in English ...GTAAAAATTAAGCACAGTGGAAGAATTTCATTCTGTTCTCAGTTTTCCTGGAT TATGCCTGGCACCATTAAAGAAAATATCTTTGGTGTTTCCTATGATGAATATAGATACA GAAGCGTCATCAAAGCATGCCAACTAGAAGAG1.... The string of these block letters (A, T, C and G) is a tiny part of the human DNA sequence, which is more than 3 billion letters long. The combination of these block letters carries genetic information, similar to howThe importance of nucleic acids in pure form for preparative and analytical perspectives, have increased constantly, demanding the development of new and more efficient methods for their recovery and isolation. This thesis describes a series of different innovative methods for recovery and purification of these biomolecules. In a general overview of a downstream processing, there are several criti
Tamoxifen (Tam) is widely used in chemotherapy of estrogen receptor-positive breast cancer. It inhibits proliferation and induces apoptosis of breast cancer cells by estrogen receptor-dependent modulation of gene expression, but recent reports have shown that Tam (especially at pharmacological concentrations) has also rapid nongenomic effects. Here we studied the mechanisms by which Tam exerts rap
Framtidsveckan VETENSKAPSVECKA | 14–20 OKTOBER 2019 | LUNDS UNIVERSITET Omställningar Omställningar. Ordet väcker tankar om genom- gripande förändringar. I Svenska Akademiens Ordbok, vars redaktion vi har glädjen att ha just här i Lund, kan vi spåra en rad historiska använd- ningar av och associationer till ordet. Man kan omställa pjäserna på ett schackbräde, vilket för tankarna till strategier oc
https://www.lu.se/sites/www.lu.se/files/framtidsveckan_2019_program_final_190923.pdf - 2026-05-20
Sweden is a country surrounded by water and consequently boating is one of the most popular spare time activities in Sweden. The active boating life, in turn, leads to a healthy boating industry in Sweden and boating production plays an important role for the Swedish industry. The company SEAFLEX AB in Umeå is one of these Swedish boating equipment manufacturers. Their new range of mooring product
Elektronisk valpåverkan med syfte att manipulera väljarbeteenden blir allt mer sofistikerad vilket medför en risk för att valpåverkan underminerar förtroendet för den demokratiska processen och därmed påverkar valdeltagandet negativt. Valpåverkan kan eventuellt också påverka valresultatet. Den teknologiska utvecklingen som möjliggör elektronisk valpåverkan är snabb och den internationella rätten Electoral cyber interference aiming to manipulate voting behaviour is becoming increasingly sophisticated, which creates a risk of the interference undermining the trust in the democratic process with declining voter turnout as a result. The interference could potentially also affect the outcome of elections. The development of the technology enabling cyber voter manipulation is rapid, and inter
Den här uppsatsen handlar om nedskräpning, insamling och återvinning av plast på Bali i Indonesien. På grund av osäkra avfallshanteringssystem, brist på kunskap och få incitament för insamling, har plastavfall en tendens att hamna i naturen där det sedan förorenar mark och vatten, och därmed utgör en risk för djurs och människors hälsa. Genom en fallstudie av den vinstdrivande och sociala organisaThis thesis studies plastic littering, collection and recycling on Bali in Indonesia. Due to unsound waste management systems, low awareness and few incentives for collection, plastic waste has the tendency to leak to the environment, where it pollutes land and water, and poses a threat to wildlife and human health. With a case study of the for-profit social enterprise the Plastic Bank that trades
Background: The current lack of knowledge among entrepreneurs to manage the e-commerce market has created an increased need for incubator activities and the support that incubators can assist entrepreneurs with. Incubators intend to contribute with support for companies by assisting with various services where the success of business development can lie in different combinations of these services
Sweden has seen an increased number of homeless EU citizens over the last years. There is no consensus among Swedish municipalities on how to handle the issue of housing for vulnerable EU citizens. The purpose of this thesis is to examine the right to housing and why vulnerable EU citizens cannot access the right. The issue is studied on three levels – human rights law, EU law and domestic Swedish
